SubtiBank SubtiBank
trpB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

trpB

tryptophan synthase (beta subunit)
locus
BSU_22640
pI
5.53
mw
43.42 kDa
protein length
400 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
biosynthesis of tryptophan
product
tryptophan synthase (beta subunit)
essential
no
ec
4.2.1.20
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,372,304 → 2,373,506

    The protein

    Catalyzed reaction/ biological activity

  • (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate + L-serine --> D-glyceraldehyde 3-phosphate + H2O + L-tryptophan (according to UniProt)
  • Protein family

  • TrpB family (single member, according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|4NEG] (from Bacillus anthracis, 60% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22640 (Δ[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCAAAATCACCGTATCTGC, downstream forward: _UP4_GTATTGGAAGAAGAGGTGAA
  • BKK22640 (Δ[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCAAAATCACCGTATCTGC, downstream forward: _UP4_GTATTGGAAGAAGAGGTGAA
  • References

    Reviews

  • 18486479,11893063,11163353,7900177,19387555,12859215,11395405,12966138
  • Original publications

  • 14976255,3924737,6436812,2422155,8419914,1551827,17507374,21815947,31871208