SubtiBank SubtiBank
phrF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phrF

response regulator aspartate phosphatase (RapF) regulator, antagonizes the RapF-ComA interaction
locus
BSU_37470
pI
10.24
mw
4.07 kDa
protein length
gene length
120 bp Sequence Blast
function
control of ComA activity
product
phosphatase (RapF) regulator
essential
no
synonyms
ywhI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    3,847,130 → 3,847,249

    The protein

    Catalyzed reaction/ biological activity

  • binds to [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], this results in the inability of [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF] to interact with [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] [Pubmed|15968044]
  • Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]-[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|15968044], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • PhrF accumulates at high cell density
  • view in new tab

    genes
    [gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
    description
    [Pubmed|11466295]

    regulation

  • PhrF accumulates at high cell density
  • view in new tab

    Biological materials

    Mutant

  • BKE37470 (Δ[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAGCCAGACAAGAGAGTA, downstream forward: _UP4_TAACCGCCGTCCATCGGCGG
  • BKK37470 (Δ[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAGCCAGACAAGAGAGTA, downstream forward: _UP4_TAACCGCCGTCCATCGGCGG
  • References

  • 16816200,15968044,11466295,16091051,22215984