SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


forespore-specific sporulation protein
14.77 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    997,175 → 997,597

    The protein

    Paralogous protein(s)

  • [protein|8529D83560E934709B20CCF0B72251A74EC272BB|YlbB]:
  • [SW|Domains]

  • 2 [SW|CBS domain]s (8-64, 72-127)
  • Structure

  • [PDB|4FRY] (protein from ''Burkholderia ambifaria'', 30% identity) [Pubmed|23382856]
  • Additional information

  • The gene is annotated in KEGG as an ortholog of IMP dehydrogenase EC No EC annotation is available in Swiss-Prot/MetaSwiss-Prot/MetaCyc.literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,12480901,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,12480901,16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-B474 (yhcV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09230 (Δ[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCAGCACCCCTTTCA, downstream forward: _UP4_TAATAAGAAAGAGCTTGCAG
  • BKK09230 (Δ[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCAGCACCCCTTTCA, downstream forward: _UP4_TAATAAGAAAGAGCTTGCAG
  • Expression vectors

  • pGP2930 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 15699190,12480901,16497325,23382856,30782632