SubtiBank SubtiBank
xylR
The papers of the month are back! Check them out! Link here

xylR

transcriptional repressor of the [gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]-[gene|search|xylB ]and [gene|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|xynP]-[gene|search|xynB ]operons
locus
BSU17590
pI
5.82
mw
38.29 kDa
protein length
350 aa Sequence Blast
gene length
1050 bp Sequence Blast
function
regulation of xylan and xylose utilization
product
transcriptional repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.5|Utilization of xylan/ xylose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,890,512 → 1,891,564

    The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the ''[gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]-[gene|F417A5B46CC7FC69DC8606A46D1AD5E41FA35B13|xylB]'' and the ''[gene|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|xynP]-[gene|19CD9BF216953613CD2E0DFB99D4C6E92AAFAE5D|xynB]'' operons
  • Protein family

  • ROK (nagC/xylR) family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|GlcK]
  • Effectors of protein activity

  • inducer: xylose
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000089 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|AF4395D134485290F4AA307B48494FED39E52CD7|xylR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/xylR.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • GP270 (erm), GP1302 (aphA3), available in the [SW|Stülke] lab
  • BKE17590 (Δ[gene|AF4395D134485290F4AA307B48494FED39E52CD7|xylR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCATCCACTCCATTTG, downstream forward: _UP4_TAATTTTTTATGGAATGGAC
  • BKK17590 (Δ[gene|AF4395D134485290F4AA307B48494FED39E52CD7|xylR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCATCCACTCCATTTG, downstream forward: _UP4_TAATTTTTTATGGAATGGAC
  • Labs working on this gene/protein

  • [SW|Wolfgang Hillen], Erlangen University, Germany [http://www.biologie.uni-erlangen.de/mibi/index2.html Homepage]
  • References

  • 7559331,7966270,25777134,7952186,8319885,2544559,1588910