SubtiBank SubtiBank
glcU
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

glcU

probable glucose uptake protein
locus
BSU_03920
pI
10.67
mw
30.74 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ycxE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    444,461 → 445,324

    The protein

    Protein family

  • GRP transporter (TC 2.A.7.5) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]-[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]
    description
    [Pubmed|3141376]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|3141376], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigG], [SW|SpoVT]) [Pubmed|3141376,8755877]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C016 (ycxE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2014 NBRP B. subtilis, Japan]
  • BKE03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT, downstream forward: _UP4_TCATAACAAATGGAGGAGGA
  • BKK03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT, downstream forward: _UP4_TCATAACAAATGGAGGAGGA
  • References

  • 3141376,8755877,27766092,29512378