SubtiBank SubtiBank
cdaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cdaA

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells
locus
BSU_01750
pI
8.07
mw
30.42 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
function
synthesis of c-di-AMP
product
diadenylate cyclase
essential
no
ec
2.7.7.85
synonyms
ybbP,ybbQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    196,213 → 197,034

    Phenotypes of a mutant

  • inactivation of ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
  • a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
  • 2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
  • Protein family

  • adenylate cyclase family (with [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|CdaS], according to UniProt)
  • Paralogous protein(s)

  • [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|CdaS]
  • [SW|Domains]

  • contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
  • [SW|DAC domain] (aa 82-242) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31118276,25605729]
  • Effectors of protein activity

  • the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|CdaR] controls the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] [Pubmed|23192352]
  • the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|CdaR] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] (shown in S. aureus) [pubmed|30668586]
  • the interaction with [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|GlmM] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]
  • Structure

  • [PDB|6HUW]
  • [PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
  • [PDB|6HVL] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
  • [SW|Localization]

  • cell membrane [Pubmed|26240071]
  • Expression and Regulation

    Operons

    genes
    [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]-[gene|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM]-[gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS]
    description
    [Pubmed|23192352]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • CdaA levels are increased at increased potassium concentrations [pubmed|28420751]
  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • GP94 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::spec, available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP997 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
  • GP2790 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::aphA3, available in [SW|Jörg Stülke]'s lab
  • GP985 (''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]''-''[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
  • BKE01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
  • BKK01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
  • Expression vectors

  • expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [SW|SPINE]: pGP1986 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • GP1339 (cat) based on [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab. Respective plasmid: pGP1990.
  • FLAG-tag construct

  • GP1381 ''cdaA-3xFLAG ermC'' (based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
  • References

    Reviews

  • 18714086,25869574,23812326,30224435,32472931,32603625
  • Original publications

  • 32250026,12884008,21566650,23192352,22211522,25605729,25616256,26240071,26527648,26585449,28420751,30668586,31118276,32250026