SubtiBank SubtiBank


diadenylate cyclase, synthesis of c-di-AMP in vegetative cells
30.42 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
synthesis of c-di-AMP
diadenylate cyclase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    196,213 → 197,034

    Phenotypes of a mutant

  • inactivation of ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
  • a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
  • 2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
  • Protein family

  • adenylate cyclase family (with [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|CdaS], according to UniProt)
  • Paralogous protein(s)

  • [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|CdaS]
  • [SW|Domains]

  • contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
  • [SW|DAC domain] (aa 82-242) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31118276,25605729]
  • Effectors of protein activity

  • the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|CdaR] controls the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] [Pubmed|23192352]
  • the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|CdaR] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] (shown in S. aureus) [pubmed|30668586]
  • Structure

  • [PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
  • [PDB|6HVL] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
  • [SW|Localization]

  • cell membrane [Pubmed|26240071]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • CdaA levels are increased at increased potassium concentrations [pubmed|28420751]
  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • GP94 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::spec, available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP997 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
  • GP2790 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::aphA3, available in [SW|Jörg Stülke]'s lab
  • GP985 (''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]''-''[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
  • BKE01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
  • BKK01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
  • Expression vectors

  • expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [SW|SPINE]: pGP1986 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • GP1339 (cat) based on [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab. Respective plasmid: pGP1990.
  • FLAG-tag construct

  • GP1381 ''cdaA-3xFLAG ermC'' (based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • References


  • 18714086,25869574,23812326,30224435
  • Original publications

  • 12884008,21566650,23192352,22211522,25605729,25616256,26240071,26527648,26585449,28420751,30668586,31118276