SubtiBank SubtiBank
yxxF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxxF

unknown
locus
BSU_39240
pI
7.96
mw
34.16 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,030,710 → 4,031,645

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 24-147, aa 166-292) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B718 (yxxF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1717 NBRP B. subtilis, Japan]
  • BKE39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC, downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT
  • BKK39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC, downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT
  • References

  • 10746760