SubtiBank SubtiBank
yvcT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvcT

similar to hydroxypyruvate reductase
locus
BSU_34680
pI
5.09
mw
36.46 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
1.1.1.215
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,562,566 → 3,563,543

    The protein

    Catalyzed reaction/ biological activity

  • D-gluconate + NADP+ --> 2-dehydro-D-gluconate + H+ + NADPH (according to UniProt)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|YoaD] and [protein|8AD1C7C761FF8B407A973381CA135C264B995CB7|SerA], according to UniProt)
  • Structure

  • [PDB|5AOV] (from Pyrococcus furiosus, 46% identity) [pubmed|26865263]
  • Additional information

  • The gene is annotated in KEGG as gluconate 2-dehydrogenase EC 1.1.1.215. The gene is marked “similar to glycerate dehydrogenase” in MetaCyc and marked as probable EC 1.1.1.215 in Swiss-Prot. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B633 (yvcT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1632 NBRP B. subtilis, Japan]
  • BKE34680 (Δ[gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCCCCCTTTATGGC, downstream forward: _UP4_TAAATCAAAAATCCGGTCTG
  • BKK34680 (Δ[gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCCCCCTTTATGGC, downstream forward: _UP4_TAAATCAAAAATCCGGTCTG
  • References

    Research papers

  • 26865263