SubtiBank SubtiBank
yqkF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqkF

NADPH-dependent 4-Hydroxy-2,3-trans-nonenal reductase
locus
BSU_23620
pI
5.13
mw
34.56 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
NADPH-dependent 4-Hydroxy-2,3-trans-nonenal reductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,459,326 → 2,460,246

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • [SW|Aldo/keto reductase 2 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS]:
  • [SW|Cofactors]

  • NADPH [Pubmed|16242712]
  • Structure

  • [PDB|1YNP] (from ''B. halodurans'', 64% identity) [Pubmed|16242712]
  • Expression and Regulation

    Operons

    genes
    [gene|B0897643562CDB25547223CCB9CFD0F9E78710E2|yqkF]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yqkF.html DBTBS]) null
    view in new tab

    genes
    [gene|08EBBA57B807F8C27C37BEB275DF5E206935C698|mciZ]-[gene|B0897643562CDB25547223CCB9CFD0F9E78710E2|yqkF]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [pubmed|18284588], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|18284588]
  • view in new tab

    Biological materials

    Mutant

  • BKE23620 (Δ[gene|B0897643562CDB25547223CCB9CFD0F9E78710E2|yqkF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCACACTCCTTTTTT, downstream forward: _UP4_TAGCAGAAAAACCAGCACCT
  • BKK23620 (Δ[gene|B0897643562CDB25547223CCB9CFD0F9E78710E2|yqkF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCACACTCCTTTTTT, downstream forward: _UP4_TAGCAGAAAAACCAGCACCT