SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)
35.91 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
acetoin utilization
acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of acetoin]
  • Gene

    879,002 → 880,003

    The protein

    Paralogous protein(s)

  • [protein|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|PdhA], [protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|BkdAA]
  • Structure

  • [PDB|6CFO] (human PDH, E1, 38% identity) [pubmed|29970614]
  • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [PubMed|11274109], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-containing [SW|RNA polymerase]) [ PubMed|11274109], in [regulon|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: indirect positive regulation, in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]) [ PubMed]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • MGNA-C280 (acoA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT, downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
  • BKK08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT, downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 22900538,21815947,11274109,10368162,10666464,12884008,16479537,11274109,16428414,29970614,31113899