SubtiBank SubtiBank
yabO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yabO

similar to heat shock protein Hsp15
locus
BSU_00590
pI
10.14
mw
9.58 kDa
protein length
gene length
261 bp Sequence Blast
function
recycling of stalled ribosomes
product
Hsp15
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • Gene

    Coordinates
    67,877 → 68,137

    The protein

    Catalyzed reaction/ biological activity

  • translocates the tRNA moiety from the A site to the P site of stalled 50S ribosomal subunits [pubmed|19013177]
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 1-62) (according to UniProt)
  • Structure

  • [PDB|3BBU] (from E. coli, 36% identity) [pubmed|19013177]
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B916 (yabO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1915 NBRP B. subtilis, Japan]
  • BKE00590 (Δ[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTATCTAATCTCA, downstream forward: _UP4_TAGGCTTGTTCTAAAAAAAC
  • BKK00590 (Δ[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTATCTAATCTCA, downstream forward: _UP4_TAGGCTTGTTCTAAAAAAAC
  • References

  • 11283287,10675343,10675344,8349564,9867837,19013177,26577401