SubtiBank SubtiBank
yabO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yabO

similar to heat shock protein Hsp15
locus
BSU_00590
pI
10.14
mw
9.58 kDa
protein length
gene length
261 bp Sequence Blast
function
recycling of stalled ribosomes
product
Hsp15
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • Gene

    Coordinates
    67,877 → 68,137

    The protein

    Catalyzed reaction/ biological activity

  • translocates the tRNA moiety from the A site to the P site of stalled 50S ribosomal subunits [pubmed|19013177]
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 1-62) (according to UniProt)
  • Structure

  • [PDB|3BBU] (from E. coli, 36% identity) [pubmed|19013177]
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B916 (yabO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1915 NBRP B. subtilis, Japan]
  • BKE00590 (Δ[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTATCTAATCTCA, downstream forward: _UP4_TAGGCTTGTTCTAAAAAAAC
  • BKK00590 (Δ[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTATCTAATCTCA, downstream forward: _UP4_TAGGCTTGTTCTAAAAAAAC
  • References

  • 11283287,10675343,10675344,8349564,9867837,19013177,26577401