SubtiBank SubtiBank
glpF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glpF

glycerol facilitator
locus
BSU_09280
pI
9.51
mw
28.59 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
glycerol uptake
product
glycerol facilitator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,002,501 → 1,003,325

    The protein

    Protein family

  • MIP/aquaporin (TC 1.A.8) family (single member, according to UniProt)
  • Structure

  • [PDB|1FX8] (the protein from ''E. coli'', 37% identity) [Pubmed|11039922]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]-[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2127799], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]-dependent [SW|RNA switch], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]) [Pubmed|8436953]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    Biological materials

    Mutant

  • GP99 (cat) (available in [SW|Jörg Stülke]'s lab)
  • BKE09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA, downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
  • BKK09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA, downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
  • References

  • 12850135,8436953,11929549,23033921,22900538,20817675,11039922,28439033,10913079