SubtiBank SubtiBank
gutP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gutP

glucitol permease
locus
BSU_06160
pI
9.81
mw
51.59 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
glucitol uptake
product
glucitol permease
essential
no
synonyms
ydjD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.11|Utilization of glucitol]
  • Gene

    Coordinates
    668,601 → 669,992

    The protein

    Protein family

  • [SW|sodium:galactoside symporter (TC 2.A.2) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|XynP], [protein|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|YjmB]
  • Structure

  • [PDB|4M64] (melibiose permease from Salmonella typhimurium, 31% identity) [pubmed|24389923]
  • Expression and Regulation

    Operons

    genes
    [gene|2E9D10B0FA5685800007222A5AAD71E975675DB1|gutB]-[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]-[gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8195086], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]: activation, [Pubmed|8195086], in [regulon|926BCA197F259558F72FDCC73998497B9B167D22|GutR regulon]
  • regulation

  • induced by glucitol ([protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]) [Pubmed|8195086]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C212 (ydjD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2210 NBRP B. subtilis, Japan]
  • BKE06160 (Δ[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCCCACCCCAAGA, downstream forward: _UP4_TAAATAGATGTAAAATTTTT
  • BKK06160 (Δ[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCCCACCCCAAGA, downstream forward: _UP4_TAAATAGATGTAAAATTTTT
  • References

  • 12897001,8195086,24389923