SubtiBank SubtiBank
ureB

ureB

urease (beta subunit)
locus
BSU_36650
pI
9.75
mw
13.50 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
function
utilization of urea as alternative nitrogen source
product
urease (beta subunit)
essential
no
ec
3.5.1.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.2|Utilization of urea]
  • Gene

    Coordinates
    3,768,420 → 3,768,794

    The protein

    Catalyzed reaction/ biological activity

  • 2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
  • Protein family

  • urease beta subunit family (single member, according to UniProt)
  • Structure

  • [PDB|3UBP] (from B. pasteurii, 48% identity) [pubmed|10368287]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
    description
    [Pubmed|9287005]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9287005], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9287005], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, [Pubmed|9287005], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9287005], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12374841], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|9287005,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
  • view in new tab

    Biological materials

    Mutant

  • BKE36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG, downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
  • BKK36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG, downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
  • References

    Reviews

  • 23539618,19363030
  • Original publications

  • 12618455,9287005,9287005,12374841,9287005,16199586,25755103,10368287