SubtiBank SubtiBank
ywpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywpE

similar to sortase, but lacking the membrane anchor
locus
BSU_36340
pI
6.34
mw
11.00 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,741,732 → 3,742,040

    The protein

    Protein family

  • bacterial sortase family (with [protein|A24243129860F1B043EBE1358FAEA57BED111BBC|YhcS], according to UniProt)
  • Structure

  • [PDB|5HU4] (sortase from Listeria monocytogenes, 49% identity) [pubmed|26826492]
  • Expression and Regulation

    Operons

    genes
    [gene|B17670494CC6F7C1138F4B4ECC0FEE8FC15609A2|ywpE]
    description
    [Pubmed|9353933]

    regulation

  • strongly repressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A588 (ywpE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/588 NBRP B. subtilis, Japan]
  • BKE36340 (Δ[gene|B17670494CC6F7C1138F4B4ECC0FEE8FC15609A2|ywpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGCCGCCCCTATCA, downstream forward: _UP4_TAAATATGCAAGAGTGAAAG
  • BKK36340 (Δ[gene|B17670494CC6F7C1138F4B4ECC0FEE8FC15609A2|ywpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGCCGCCCCTATCA, downstream forward: _UP4_TAAATATGCAAGAGTGAAAG
  • References

    Reviews

  • 22026821
  • Research papers

  • 26826492,30792386