SubtiBank SubtiBank
pabB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pabB

para-aminobenzoate synthase (subunit A)
locus
BSU_00740
pI
5.23
mw
53.09 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
biosynthesis of folate
product
para-aminobenzoate synthase (subunit A)
essential
no
ec
2.6.1.85
synonyms
pab

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.5|Biosynthesis of folate]
  • Gene

    Coordinates
    82,864 → 84,276

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate + L-glutamine --> 4-amino-4-deoxychorismate + L-glutamate (according to UniProt)
  • Protein family

  • Anthranilate synthase component I family (with [protein|48C33A96F3B446440D4D9A86AA07AA3BA244063D|TrpE], according to UniProt)
  • Structure

  • [PDB|5CWA] (from ''Mycobacterium tuberculosis'', 39% identity) [Pubmed|26527146]
  • Expression and Regulation

    Operons

    genes
    [gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
    description
    [Pubmed|9084182]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    Biological materials

    Mutant

  • BKE00740 (Δ[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCATTCCTCTAT, downstream forward: _UP4_AAAATTAGATGAGGTGAGCG
  • BKK00740 (Δ[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCATTCCTCTAT, downstream forward: _UP4_AAAATTAGATGAGGTGAGCG
  • References

  • 9084182,26527146