SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative tRNA-dihydrouridine synthase 2
36.83 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
tRNA modification
putative tRNA-dihydrouridine synthase 2

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    876,426 → 877,403

    The protein

    Catalyzed reaction/ biological activity

  • 5,6-dihydrouridine in tRNA + NAD+ → uridine in tRNA + H+ + NADH (according to UniProt)
  • 5,6-dihydrouridine in tRNA + NADP+ → uridine in tRNA + H+ + NADPH (according to UniProt)
  • Protein family

  • Dus family (with [protein|CE45D56BC413555AF4E7914B5307AD967A358452|YacF], according to UniProt)
  • Paralogous protein(s)

  • [protein|CE45D56BC413555AF4E7914B5307AD967A358452|YacF]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|3B0P] (from Thermus thermophilus, 24% identity, from aa 12 ... 263) [pubmed|22123979]
  • Expression and Regulation




  • the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-C277 (yfjN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08030 (Δ[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|yfjN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAAATCAAATCCT, downstream forward: _UP4_TAACAGCAGTGCTTGATTCA
  • BKK08030 (Δ[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|yfjN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAAATCAAATCCT, downstream forward: _UP4_TAACAGCAGTGCTTGATTCA
  • References

  • 25902496,22123979,29794222