SubtiBank SubtiBank
yclH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yclH

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_03730
pI
8.17
mw
25.06 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    424,208 → 424,888

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-226) (according to UniProt)
  • Structure

  • [PDB|1L2T] (from Methanocaldococcus jannaschii, 33% identity) [pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|YclI]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]-[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]
    description
    [Pubmed|20512483]

    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C005 (yclH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2003 NBRP B. subtilis, Japan]
  • BKE03730 (Δ[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGCTCATAGGTTCCGCCT, downstream forward: _UP4_TAACAAAACGCGCCTCTGCC
  • BKK03730 (Δ[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGCTCATAGGTTCCGCCT, downstream forward: _UP4_TAACAAAACGCGCCTCTGCC
  • References

  • 10092453,20512483,12150914