SubtiBank SubtiBank
yueD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yueD

similar to sepiapterin reductase
locus
BSU_31840
pI
6.43
mw
26.96 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,265,406 → 3,266,137

    The protein

    Catalyzed reaction/ biological activity

  • (S)-benzoin + NADP+ --> benzil + H+ + NADPH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Structure

  • [PDB|5IF3] (from Burkholderia Vietnamiensis 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|yukC]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B564 (yueD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1563 NBRP B. subtilis, Japan]
  • BKE31840 (Δ[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAAACCTCCTTTTCC, downstream forward: _UP4_TAGAGCAGATATTTTCTGCT
  • BKK31840 (Δ[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAAACCTCCTTTTCC, downstream forward: _UP4_TAGAGCAGATATTTTCTGCT