SubtiBank SubtiBank
cotY
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotY

main structural component of the spore crust, necessary for the assembly of the spore crust, the outermost layer of the spore coat
locus
BSU_11750
pI
4.86
mw
17.74 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
spore crust assembly
product
spore crust protein (insoluble fraction)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,250,016 → 1,250,504

    The protein

    Paralogous protein(s)

  • [protein|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|CotZ]
  • [SW|Localization]

  • spore crust [Pubmed|21665972]
  • localization requires [protein|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|CotZ] [Pubmed|21665972]
  • Expression and Regulation

    Operons

    genes
    [gene|B2636947990A303C43CEA8BFBE38811DD233A0A6|cotY]-[gene|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|cotZ]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7519271,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401,15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|7519271,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE11750 (Δ[gene|B2636947990A303C43CEA8BFBE38811DD233A0A6|cotY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTCAGCTCCTTCT, downstream forward: _UP4_TAAACACTTGTAAAGAGGAA
  • BKK11750 (Δ[gene|B2636947990A303C43CEA8BFBE38811DD233A0A6|cotY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTCAGCTCCTTCT, downstream forward: _UP4_TAAACACTTGTAAAGAGGAA
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 19304857,7519271,15699190,15621419,20451384,21665972,16980471,25872412,26341943,26821119,26577401,28870294,30582883,31502725