SubtiBank SubtiBank


mechanosensitive channel, essential for the uptake of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 ) into developing spores, required for spore maturation
15.97 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
spore maturation
mechanosensitive channel

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,441,804 → 2,442,256

    The protein


  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    Biological materials


  • BKE23420 (Δ[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAACCTCCTTATG, downstream forward: _UP4_CTGATGTCATAGGAGGAGAA
  • BKK23420 (Δ[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAACCTCCTTATG, downstream forward: _UP4_CTGATGTCATAGGAGGAGAA
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 3114420,11751839,15451103,3926949,17158659,6432957,7934830,15699190,1903432,8755877,22328679,21398556,24666282,24752279,26731423