SubtiBank SubtiBank
spoVAC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVAC

mechanosensitive channel, essential for the uptake of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 ) into developing spores, required for spore maturation
locus
BSU_23420
pI
9.46
mw
15.97 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
spore maturation
product
mechanosensitive channel
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,441,804 → 2,442,256

    The protein

    [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation

    Operons

    genes
    [gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE23420 (Δ[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAACCTCCTTATG, downstream forward: _UP4_CTGATGTCATAGGAGGAGAA
  • BKK23420 (Δ[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAACCTCCTTATG, downstream forward: _UP4_CTGATGTCATAGGAGGAGAA
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 3114420,11751839,15451103,3926949,17158659,6432957,7934830,15699190,1903432,8755877,22328679,21398556,24666282,24752279,26731423