SubtiBank SubtiBank
ybfM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybfM

similar to alkaline phosphatase
locus
BSU_02280
pI
9.48
mw
18.20 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    248,268 → 248,756

    The protein

    Protein family

  • dedA family (with [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC] and [protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|YkoX], according to UniProt)
  • Paralogous protein(s)

  • [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC]
  • [protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|YkoX]:
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
    description
    [Pubmed|22383849,14762009]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE02280 (Δ[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT, downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT
  • BKK02280 (Δ[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT, downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT
  • References

  • 14762009