SubtiBank SubtiBank
yueG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yueG

unknown
locus
BSU_31790
pI
4.33
mw
7.44 kDa
protein length
gene length
222 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,262,330 → 3,262,551

    The protein

    Protein family

  • [SW|GerPA/GerPF family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B2C2A0CFE8CA41AF843A406D30DC6AC482399A5C|yueG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A643 (yueG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/643 NBRP B. subtilis, Japan]
  • BKE31790 (Δ[gene|B2C2A0CFE8CA41AF843A406D30DC6AC482399A5C|yueG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCACCTCCGCATT, downstream forward: _UP4_TAACAGCCTTTTCACAAGAG
  • BKK31790 (Δ[gene|B2C2A0CFE8CA41AF843A406D30DC6AC482399A5C|yueG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCACCTCCGCATT, downstream forward: _UP4_TAACAGCCTTTTCACAAGAG