SubtiBank SubtiBank
yhdT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhdT

similar to magnesium exporter
locus
BSU_09590
pI
4.75
mw
51.35 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.1|Magnesium uptake/ efflux]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,035,554 → 1,036,939

    The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|YhdP], [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|YqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS]
  • [SW|Domains]

  • [SW|CNNM transmembrane domain] (aa 1-202) (according to UniProt)
  • [SW|DUF21 domain] (7-202)
  • 2 [SW|CBS domain]s (aa 221-280, aa 290-347) (according to UniProt)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A698 (yhdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/698 NBRP B. subtilis, Japan]
  • BKE09590 (Δ[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAACCCTATCCTCTCA, downstream forward: _UP4_AGCGAGAAATAAGCTCAAGG
  • BKK09590 (Δ[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAACCCTATCCTCTCA, downstream forward: _UP4_AGCGAGAAATAAGCTCAAGG
  • Expression vectors

  • pGP2928 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 20525796,27120414,27933050,31415562