SubtiBank SubtiBank
ctaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ctaA

heme A synthase
locus
BSU_14870
pI
9.64
mw
33.93 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
heme biosynthesis
product
heme A synthase
essential
no
ec
1.3.-.-
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,558,034 → 1,558,954

    The protein

    Catalyzed reaction/ biological activity

  • heme A synthesis from protoheme IX (heme B)
  • Protein family

  • COX15/ctaA family (single member, according to UniProt)
  • [SW|Domains]

  • contains 8 transmembrane segments
  • [SW|Cofactors]

  • heme B
  • Structure

  • [PDB|6A2J] [pubmed|30397130]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B308BDECB15D68DF0EC2E49341DB5E7F9B3E14D1|ctaA]
    description
    [Pubmed|2549007]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11325953], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|2549007,11325953], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972837,11325953], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972837,11325953]
  • view in new tab

    Biological materials

    Mutant

  • BKE14870 (Δ[gene|B308BDECB15D68DF0EC2E49341DB5E7F9B3E14D1|ctaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATATTCACCTTCTT, downstream forward: _UP4_TAAGGACTCAAGACCAAAGC
  • BKK14870 (Δ[gene|B308BDECB15D68DF0EC2E49341DB5E7F9B3E14D1|ctaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATATTCACCTTCTT, downstream forward: _UP4_TAAGGACTCAAGACCAAAGC
  • References

    Reviews

  • 22484221
  • Original publications

  • 15576792,7961419,16321940,11325953,18358840,7968515,15491161,10972837,8665949,10972837,2549007,19174544,26592143,30397130