SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


negative regulator of [protein|search|FtsZ ]ring formation
64.82 kDa
protein length
562 aa Sequence Blast
gene length
1689 bp Sequence Blast
control of [protein|search|FtsZ ]ring formation
[protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]-interacting protein, member of the [SW|divisome]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,029,729 → 3,031,417

    Phenotypes of a mutant

  • altered localization of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] and [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]]] [Pubmed|25403286]
  • growth defects, elongated cells [Pubmed|25403286]
  • the ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' mutation is synthetically lethal with a ''[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]'' mutation [Pubmed|24218584]
  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • a ''[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA] [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' double mutant forms filamentous cells [Pubmed|16420366]
  • depletion of ''[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]'' and deletion of ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' have a strong synthetic defect in [SW|cell division] [Pubmed|24825009]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] polymerization [Pubmed|25403286]
  • recruits [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]]] to the division septum [Pubmed|25403286]
  • activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|25845974]
  • Protein family

  • EzrA family (single member, according to UniProt)
  • Effectors of protein activity

  • degradation of [protein|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|EzrA] involves [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|24222488]
  • Structure

  • [PDB|4UXV] (the 60 kDa cytoplasmic domain) [Pubmed|25403286]
  • [SW|Localization]

  • cell membrane (integral) [Pubmed|10449747]
  • 1 transmembrane domain at the N-terminus [Pubmed|25403286]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15317798], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • additional information

  • degradation of [protein|search|EzrA] involves [protein|search|FtsH] [PubMed|24222488]
  • view in new tab

    Biological materials


  • MGNA-A428 (ytwP::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A805 ( ''ezrA''::''kan''), [Pubmed|15101985], available at [ BGSC]
  • 1A1279 (''ezrA''::''spec''), [Pubmed|10449747], available at [ BGSC]
  • 1A1280 (''ezrA-gfp''), [Pubmed|10449747], available at [ BGSC]
  • BKE29610 (Δ[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG, downstream forward: _UP4_TAGATAATCACGACCATGAA
  • BKK29610 (Δ[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG, downstream forward: _UP4_TAGATAATCACGACCATGAA
  • References


  • 19680248,19884039,28357277,31405912
  • Original Publications

  • 10449747,16420366,15317782,16549676,17662947,12368265,18363795,9387221,15317798,19429628,18763711,21401734,24222488,23701187,17718511,24218584,24097947,24825009,25068683,25403286,25845974,25954268,31287946