SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


type I pantothenate kinase, major enzyme
36.49 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
biosynthesis of coenzyme A
pantothenate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • Gene

    2,468,549 → 2,469,508

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantothenate + ATP --> (R)-4'-phosphopantothenate + ADP + H+ (according to UniProt)
  • Protein family

  • prokaryotic pantothenate kinase family (single member, according to UniProt)
  • Structure

  • [PDB|1SQ5] (from ''Escherichia coli'', 49% identity, 67% similarity) [Pubmed|15136582]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C399 (yqjS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT, downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
  • BKK23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT, downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
  • References

  • 1328157,24784177