SubtiBank SubtiBank
ycbR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbR

similar to toxic cation resistance protein
locus
BSU_02610
pI
9.06
mw
27.87 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • Gene

    Coordinates
    283,003 → 283,734

    The protein

    [SW|Domains]

  • [SW|VWFA domain] (aa 26-204) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B36B1142A539955A93216D4A632C38860A469AE1|ycbR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE02610 (Δ[gene|B36B1142A539955A93216D4A632C38860A469AE1|ycbR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCATCTCCGTCAG, downstream forward: _UP4_TAACTGATAAAGAGCACTGA
  • BKK02610 (Δ[gene|B36B1142A539955A93216D4A632C38860A469AE1|ycbR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCATCTCCGTCAG, downstream forward: _UP4_TAACTGATAAAGAGCACTGA