SubtiBank SubtiBank
mdr
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mdr

multidrug-efflux transporter (puromycin, nerfloxacin, tosufloxacin)
locus
BSU_03070
pI
9.70
mw
46.65 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
function
drug resistance
product
multidrug-efflux transporter (puromycin, nerfloxacin, tosufloxacin)
essential
no
synonyms
ycgD,bmr3

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    332,441 → 333,979

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • Structure

  • [PDB|6OOM] (from E. coli, corresponds to aa 51 ... 412, 22% identity) [pubmed|31240248]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE03070 (Δ[gene|B36B4BE77A207C5B16876D8E656266C8BA650B76|mdr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCTACCTCCTCTT, downstream forward: _UP4_TAACATAAAAAAAGCAGTAC
  • BKK03070 (Δ[gene|B36B4BE77A207C5B16876D8E656266C8BA650B76|mdr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCTACCTCCTCTT, downstream forward: _UP4_TAACATAAAAAAAGCAGTAC
  • References

  • 12850135,31240248