SubtiBank SubtiBank
arsR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

arsR

transcriptional regulator of the [SW|ArsR family], arsenic resistance operon repressor
locus
BSU_25810
pI
4.88
mw
12.15 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
regulation of As (III) efflux
product
transcription repressor ([SW|ArsR family])
essential
no
synonyms
yqcJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,657,317 → 2,657,634

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 4-99) (according to UniProt)
  • Structure

  • [PDB|1U2W] (CadC from Staphylococcus aureus, 36% identity) [pubmed|15937183]
  • Expression and Regulation

    Operons

    genes
    [gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]-[gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]-[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]-[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]
    description
    [Pubmed|9537360]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE25810 (Δ[gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATATCGCCTTCTTTA, downstream forward: _UP4_TAAAAAAATTTTTTAGGTAT
  • BKK25810 (Δ[gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATATCGCCTTCTTTA, downstream forward: _UP4_TAAAAAAATTTTTTAGGTAT
  • References

  • 15948947,9537360,16497325,15937183