SubtiBank SubtiBank
putP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

putP

high affinity proline permease
locus
BSU_03220
pI
8.62
mw
48.25 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
proline uptake
product
high affinity proline permease
essential
no
synonyms
ycgO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.7|Sodium-solute symporter]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.2|Biosynthesis/ acquisition of proline]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.2|Utilization of proline]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    347,150 → 348,571

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of proline coupled to the uptake of sodium ions
  • Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6A1F759DAC09D364602460E5467E2761E97CE45C|OpuE]
  • Structure

  • [PDB|2XQ2] (from ''Vibrio parahaemolyticus'', 26% identity) [Pubmed|21131949]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]
    description
    (internal promoter) [Pubmed|21840319]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab

    genes
    [gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]
    description
    [Pubmed|21840319,22139509]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR] [Pubmed|21840319], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
  • the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B994 (ycgO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1993 NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE03220 (Δ[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG
  • BKK03220 (Δ[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG
  • References

  • 21840319,21964733,22139509,24142252,21131949,26728461,26883633