SubtiBank SubtiBank
cccA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cccA

cytochrome c550
locus
BSU_25190
pI
5.28
mw
12.63 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
respiration
product
cytochrome c550
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,599,523 → 2,599,885

    The protein

    [SW|Domains]

  • transmembrane domain at the N-terminus (aa 5 -25) [Pubmed|2166045]
  • [SW|Cofactors]

  • heme c [Pubmed|2166045]
  • [SW|Localization]

  • cell membrane [Pubmed|2166045]
  • Expression and Regulation

    Operons

    genes
    [gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11361075], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, cre site overlaps -35 region of the promoter [Pubmed|11361075], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|22900538,11361075,12850135]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE25190 (Δ[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT, downstream forward: _UP4_TAAAAGAACTATTTTTCTCT
  • BKK25190 (Δ[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT, downstream forward: _UP4_TAAAAGAACTATTTTTCTCT
  • References

  • 2171986,10024472,12884008,8383048,2166045,12850135,11361075,22900538,22900538,22383849,20817675,10473570,27503613