SubtiBank SubtiBank
ypgR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypgR

unknown
locus
BSU_21880
pI
4.77
mw
42.41 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,302,727 → 2,303,860

    Expression and Regulation

    Operons

    genes
    [gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]-[gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]-[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A889 (ypgR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/889 NBRP B. subtilis, Japan]
  • BKE21880 (Δ[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCGTCCTCCTATAGC, downstream forward: _UP4_TAAAGATAAAAAAGGTGCAG
  • BKK21880 (Δ[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCGTCCTCCTATAGC, downstream forward: _UP4_TAAAGATAAAAAAGGTGCAG