SubtiBank SubtiBank
ylaD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylaD

redox sensor, control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]
locus
BSU_14740
pI
4.47
mw
11.27 kDa
protein length
gene length
294 bp Sequence Blast
function
control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]
product
anti-Sigma ([protein|544344B61A804F367BB726976E0C87B61998490A|YlaC])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,544,603 → 1,544,896

    The protein

    Protein family

  • zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    genes
    [gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A535 (ylaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/535 NBRP B. subtilis, Japan]
  • BKE14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC, downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
  • BKK14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC, downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
  • References

  • 16501307,16728958,29760236