SubtiBank SubtiBank
ytoI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytoI

similar to transcriptional regulator ([SW|GntR family])
locus
BSU_29270
pI
6.59
mw
48.87 kDa
protein length
439 aa Sequence Blast
gene length
1320 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,997,301 → 2,998,620

    Phenotypes of a mutant

  • an ''ytoI'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • 2 [SW|CBS domain]s (195-254, 256-314)
  • Expression and Regulation

    Operons

    genes
    [gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]
    description
    [Pubmed|9387221]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for'[protein|search|ytoI]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A152 (ytoI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/152 NBRP B. subtilis, Japan]
  • GP2213 (''[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP2214 (''[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • BKE29270 (Δ[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCCTTTCACCTCTAAGG, downstream forward: _UP4_AGCTAAGGGACGTTCAGGCG
  • BKK29270 (Δ[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCCTTTCACCTCTAAGG, downstream forward: _UP4_AGCTAAGGGACGTTCAGGCG
  • Expression vectors

  • pGP2933 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16479537,9387221,20525796,23504016,26296725