SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


nitric-oxide synthase
38.59 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
production of nitric oxide
nitric-oxide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    836,653 → 837,744

    The protein

    Catalyzed reaction/ biological activity

  • NADPH-dependent oxidation of l-arginine into l-citrulline [Pubmed|25826316]
  • 2 L-arginine + 4 O2 + 3 reduced [flavodoxin] --> 5 H+ + 4 H2O + 2 L-citrulline + 2 nitric oxide + 3 oxidized [flavodoxin] (according to UniProt)
  • Protein family

  • NOS family (single member, according to UniProt)
  • [SW|Cofactors]

  • heme b [Pubmed|20006999]
  • NADPH [Pubmed|25826316]
  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|2AMO] (loose dimer), [PDB|1M7V] (bound to tetrahydrofolate and arginine)
  • Expression and Regulation



    additional information

  • Note that the [gene|D7C46835B9984E2C5E375816F2BB16566202CF27|yflL] is located between [gene|B51ADFB53CA54309D866BB089502639E9571238B|nos] and [gene|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|yflK], but on the opposite strand
  • view in new tab

    Biological materials


  • MGNA-C254 (yflM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07630 (Δ[gene|B51ADFB53CA54309D866BB089502639E9571238B|nos]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAACTCTCCCCTTCAC, downstream forward: _UP4_AACTATTTTTATCAAGATAA
  • BKK07630 (Δ[gene|B51ADFB53CA54309D866BB089502639E9571238B|nos]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAACTCTCCCCTTCAC, downstream forward: _UP4_AACTATTTTTATCAAGATAA
  • References


  • 9818193
  • Original publications

  • 12220171,11856757,20006999,21599925,22119809,23943262,21310962,21921039,25194416,25826316,26062720,28074650