SubtiBank SubtiBank
ansZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ansZ

L-asparaginase
locus
BSU_02690
pI
6.15
mw
39.94 kDa
protein length
375 aa Sequence Blast
gene length
1128 bp Sequence Blast
function
utilization of asparagine
product
L-asparaginase
essential
no
ec
3.5.1.1
synonyms
yccC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.6|Utilization of asparagine/ aspartate]
  • Gene

    Coordinates
    290,915 → 292,042

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-asparagine --> L-aspartate + NH4+(according to UniProt)
  • Protein family

  • asparaginase 1 family (with [protein|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|AnsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|AnsA]
  • [SW|Domains]

  • Asparaginase/glutaminase domain (aa 51-375) (according to UniProt)
  • Structure

  • [PDB|1ZCF] (from ''Pectobacterium atrosepticum scri1043'', 55% identity, 73% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|B5301B346FBAAE2D7C37D561FE1DCFDDFAC90D40|ansZ]
    description
    [Pubmed|11914346]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11914346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|11914346], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|11914346]
  • view in new tab

    Biological materials

    Mutant

  • BKE02690 (Δ[gene|B5301B346FBAAE2D7C37D561FE1DCFDDFAC90D40|ansZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCTCCTTACA, downstream forward: _UP4_TGAAGAAAAGAAGGCGAATA
  • BKK02690 (Δ[gene|B5301B346FBAAE2D7C37D561FE1DCFDDFAC90D40|ansZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCTCCTTACA, downstream forward: _UP4_TGAAGAAAAGAAGGCGAATA
  • References

  • 24003863,11914346,12618455,26672444,27796436