SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acyl-CoA dehydrogenase
65.16 kDa
protein length
594 aa Sequence Blast
gene length
1785 bp Sequence Blast
fatty acid degradation
acyl-CoA dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,367,040 → 3,368,824

    The protein

    Catalyzed reaction/ biological activity

  • A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
  • Protein family

  • [SW|Acyl-CoA dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|YngJ], [protein|7D89BBB52403BF99416250688EFA90C2BE8EB591|AcdA]
  • [protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|MmgC]: (40.2%)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2Z1Q] (from ''Thermus thermophilus hb8'', 52% identity, 68% similarity)
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|4787161A022E938A6D58A505D92369F889C7DE04|FadN]'': induced by long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab


    regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • ''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-A602 (yusJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32820 (''[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE32820 (Δ[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTTCCCCCTTTA, downstream forward: _UP4_TGATTGGCCATGAGCTCCGC
  • BKK32820 (Δ[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTTCCCCCTTTA, downstream forward: _UP4_TGATTGGCCATGAGCTCCGC
  • References

  • 17189250,12817086,18763711,23033921,21398533