SubtiBank SubtiBank
ydhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydhC

similar to transcriptional regulator ([SW|GntR family])
locus
BSU_05700
pI
5.79
mw
26.25 kDa
protein length
224 aa Sequence Blast
gene length
675 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|GntR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    615,871 → 616,545

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|6AZ6] ([protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR] from Streptococcus agalactiae, 30% identity) [pubmed|29269393]
  • Expression and Regulation

    Operons

    genes
    [gene|B585209B07593C1078ED6DA1741B808E13B0B625|ydhC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C178 (ydhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2176 NBRP B. subtilis, Japan]
  • BKE05700 (Δ[gene|B585209B07593C1078ED6DA1741B808E13B0B625|ydhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAATACCTCTTTTG, downstream forward: _UP4_TGATTTGTATGATCCGGTAC
  • BKK05700 (Δ[gene|B585209B07593C1078ED6DA1741B808E13B0B625|ydhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAATACCTCTTTTG, downstream forward: _UP4_TGATTTGTATGATCCGGTAC
  • References

  • 23504016,29269393