SubtiBank SubtiBank


A/G-specific adenine glycosylase, error prevention oxidized guanine system, releases adenines from 8-oxo-G:A mismatches
41.81 kDa
protein length
369 aa Sequence Blast
gene length
1110 bp Sequence Blast
DNA repair
A/G-specific adenine glycosylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Oxidized guanine (GO) DNA repair system]
  • Gene

    935,656 → 936,765

    Phenotypes of a mutant

  • strongly reduced stationary phase mutagenesis [Pubmed|27399782]
  • increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
  • The protein

    Catalyzed reaction/ biological activity

  • releases adenines from 8-oxo-G:A mismatches
  • Hydrolyzes free adenine bases from 7,8-dihydro-8-oxoguanine:adenine mismatched double-stranded DNA, leaving an apurinic site (according to UniProt)
  • Protein family

  • Nth/MutY family (with [protein|C352560155F5B2E951B5059794D7B319C1A3AF2C|Nth], according to UniProt)
  • [SW|Domains]

  • HhH domain (aa 108-137) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1RRS] (complex with DNA, Geobacillus stearothermophilus)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10463184], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1900507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP]: repression, in [regulon|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP regulon]
  • regulation

  • expression is constitutive throughout growth [Pubmed|20971907]
  • view in new tab

    Biological materials


  • MGNA-C322 (yfhQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08630 (Δ[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCCCAGT, downstream forward: _UP4_ATCTCGGCTGCTCCGTAAAC
  • BKK08630 (Δ[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCCCAGT, downstream forward: _UP4_ATCTCGGCTGCTCCGTAAAC
  • References


  • 22933559
  • Original publications

  • 10463184,19011023,20971907,24973075,25326311,25995449,27399782,30691388