SubtiBank SubtiBank
ywjE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywjE

minor cardiolipin synthetase
locus
BSU_37190
pI
9.05
mw
45.68 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
phospholipid biosynthesis
product
minor cardiolipin synthetase
essential
no
synonyms
clsB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,816,654 → 3,817,850

    The protein

    Protein family

  • phospholipase D family (with [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA] and [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], according to UniProt)
  • Paralogous protein(s)

  • [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA]
  • [SW|Domains]

  • 2 PLD phosphodiesterase domains (aa 141-168, aa 311-338) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]-[gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]
    description
    [Pubmed|22383849]

    additional information

  • there is an antisense transcript for [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE] ([gene|22198D5928526CC964233355352D085D0A15DEE8|S1445]) [PubMed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A554 (ywjE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/554 NBRP B. subtilis, Japan]
  • BKE37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT
  • BKK37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT
  • References

  • 18820022,14973018,16514141,22383849