The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywjE

minor cardiolipin synthetase

locus: BSU_37190

pI: 9.05

mw: 45.68 kDa

protein length: 398 aa

gene length: 1197 bp

function: phospholipid biosynthesis

product: minor cardiolipin synthetase

essential: no

synonyms: clsB

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,816,654 → 3,817,850

The protein

Protein family

• phospholipase D family (with [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA] and [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], according to UniProt)

Paralogous protein(s)

• [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA]

[SW|Domains]

• 2 PLD phosphodiesterase domains (aa 141-168, aa 311-338) (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]-[gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]
  description: [Pubmed|22383849]

  additional information

  • there is an antisense transcript for [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE] ([gene|22198D5928526CC964233355352D085D0A15DEE8|S1445]) [PubMed|22383849]

Biological materials

Mutant

• MGNA-A554 (ywjE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/554 NBRP B. subtilis, Japan]
• BKE37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT
• BKK37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT

References

• 18820022,14973018,16514141,22383849