SubtiBank SubtiBank
yvzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvzF

unknown
locus
BSU_33049
pI
9.40
mw
7.30 kDa
protein length
gene length
186 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,390,479 → 3,390,664

    Expression and Regulation

    Operons

    genes
    [gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]-[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE33049 (Δ[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCGTATCCTCCGCTTT, downstream forward: _UP4_TAAAAAGGATTTTTTGTGTC
  • BKK33049 (Δ[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCGTATCCTCCGCTTT, downstream forward: _UP4_TAAAAAGGATTTTTTGTGTC