SubtiBank SubtiBank
yvfR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvfR

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_34090
pI
6.17
mw
33.63 kDa
protein length
301 aa Sequence Blast
gene length
906 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,498,352 → 3,499,257

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 6-230) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, 32% identity)
  • [SW|Localization]

  • plasma membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]-[gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]
    description
    [Pubmed|26647299]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A481 (yvfR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/481 NBRP B. subtilis, Japan]
  • BKE34090 (Δ[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGAGCACCTCCTGATC, downstream forward: _UP4_GACGGCAACAGGGAGGCGAT
  • BKK34090 (Δ[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGAGCACCTCCTGATC, downstream forward: _UP4_GACGGCAACAGGGAGGCGAT
  • References

  • 10092453,26647299,28461449