SubtiBank SubtiBank
yomG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yomG

unknown
locus
BSU_21370
pI
5.21
mw
98.69 kDa
protein length
875 aa Sequence Blast
gene length
2628 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,256,832 → 2,259,459

    The protein

    [SW|Domains]

  • Fibronectin type-III domain (aa 537-648) (according to UniProt)
  • Biological materials

    Mutant

  • BKE21370 (Δ[gene|B6C6C999FF0CF308C97EA3E7C0AD184D6D382499|yomG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTATTTAACAAAATACATC, downstream forward: _UP4_CAAAATTAACGGAGGTGAAC
  • BKK21370 (Δ[gene|B6C6C999FF0CF308C97EA3E7C0AD184D6D382499|yomG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTATTTAACAAAATACATC, downstream forward: _UP4_CAAAATTAACGGAGGTGAAC