SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


histidinol phosphate phosphatase
30.33 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
biosynthesis of histidine
histidinol phosphate phosphatase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of histidine]
  • Gene

    3,031,614 → 3,032,420

    Phenotypes of a mutant

  • auxotroph for histidine
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + L-histidinol phosphate --> L-histidinol + phosphate (according to UniProt)
  • Protein family

  • PHP hydrolase family (single member, according to UniProt)
  • Structure

  • [PDB|3DCP] (from Listeria monocytogenes, 35% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A427 (ytvP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29620 (Δ[gene|B6C931049CF7353042EB3714976735189ADAF0FD|hisJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCACCCCATGAA, downstream forward: _UP4_TATGAGGCGTTTTTGGAACG
  • BKK29620 (Δ[gene|B6C931049CF7353042EB3714976735189ADAF0FD|hisJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCACCCCATGAA, downstream forward: _UP4_TATGAGGCGTTTTTGGAACG
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 10322033