SubtiBank SubtiBank
ycdF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycdF

general stress protein, similar to glucose 1-dehydrogenase, survival of ethanol stress and low temperatures
locus
BSU_02830
pI
5.74
mw
27.62 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
function
survival of ethanol stress and low temperatures
product
unknown
essential
no
ec
1.1.1.47
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    305,658 → 306,434

    The protein

    Catalyzed reaction/ biological activity

  • Beta-D-glucose + NAD(P)+ --> D-glucono-1,5-lactone + NAD(P)H (according to UniProt)
  • Beta-D-glucose + NAD+ --> D-glucono-1,5-lactone + NADH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC], [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|YmfI], [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG], [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|YoxD]
  • [protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|Gdh]:
  • [protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|FadH]:
  • [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]:
  • [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD]:
  • [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD]:
  • [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL]:
  • Structure

  • [PDB|1GEE] (from ''Bacillus megaterium'', 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]-[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]
    description
    [Pubmed|15805528]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C046 (ycdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2044 NBRP B. subtilis, Japan]
  • BKE02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT, downstream forward: _UP4_TAGAAGACAAAACAGGGGGA
  • BKK02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT, downstream forward: _UP4_TAGAAGACAAAACAGGGGGA
  • References

  • 10220166,15805528