SubtiBank SubtiBank
yccK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yccK

similar to aldo/ ketoreductase
locus
BSU_02770
pI
5.01
mw
34.65 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yzaE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • Gene

    Coordinates
    298,466 → 299,398

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • [SW|Aldo/keto reductase 2 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS], [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN]
  • [protein|35E890DE5096DF603FC16EF5F2CDF329CE104690|YrpG]:
  • Structure

  • [PDB|1PZ0] ([protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS], 53% identity) [Pubmed|15019785]
  • Expression and Regulation

    Operons

    genes
    [gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]
    description
    [Pubmed|17322186]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B977 (yccK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1976 NBRP B. subtilis, Japan]
  • BKE02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA, downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
  • BKK02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA, downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
  • References

  • 17322186