SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


extrusion of arsenite
38.10 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
detoxification of arsenate and arsenite
arsenite exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,655,753 → 2,656,793

    The protein

    Protein family

  • arsenical resistance-3 (ACR3) (TC 2.A.59) family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • BKK25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • References

  • 9537360,16497325,9537360