The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
cell wall-anchored 3'5' cyclic dinucleotide 3' phosphodiesterase, degrades c-di-AMP
function
degradation of c-di-AMP
product
cell wall-anchored 3'5' cyclic dinucleotide 3′ phosphodiesterase, degrades c-di-AMP
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides][category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]Gene
Coordinates
855,114 → 859,502
Phenotypes of a mutant
essential according to Kobayshi ''et al.'' [Pubmed|17114254], but a deletion mutant could be constructed [Pubmed|27681641]The protein
Catalyzed reaction/ biological activity
degrades c-di-AMP two 5′ AMP molecules [Pubmed|27414497]nucleoside 2',3'-cyclic phosphate + H2O --> nucleoside 3'-phosphate + H+ (according to UniProt)ribonucleoside 3'-phosphate + H2O --> ribonucleoside + phosphate (according to UniProt)ribonucleoside 5'-phosphate + H2O --> ribonucleoside + phosphate (according to UniProt)Protein family
5'-nucleotidase family (with [protein|DAFBC470DA0FA437B117716DE899A8D3EC454672|YhcR], according to UniProt)Paralogous protein(s)
[protein|DAFBC470DA0FA437B117716DE899A8D3EC454672|YhcR] [SW|Cofactors]
Mn2+ [Pubmed|27414497]Structure
[PDB|2Z1A] (from Thermus thermophilus, 40% identity)[PDB|3GVE] (fragment, aa 37 - 374)[SW|Localization]
extracellular (signal peptide) [Pubmed|18957862], the transmembrane domain serves as retention signal, attached to the cell wall [Pubmed|21800427,22767609]Expression and Regulation
Operons
genes
[gene|B791B0603042603CB5B5E03CA129B20D02BC02BC|yfkN]
description
[Pubmed|16291680]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon][protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16291680], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]view in new tabBiological materials
Mutant
GP2026 (Δ''yfkN::aphA3''), available in [SW|Jörg Stülke]'s lab [Pubmed|27681641]MGNA-C263 (yfkN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2261 NBRP B. subtilis, Japan]BKE07840 (Δ[gene|B791B0603042603CB5B5E03CA129B20D02BC02BC|yfkN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCAGTTCTCCACCTTTCA, downstream forward: _UP4_TAAAAAAGAGCTGCTCGCTABKK07840 (Δ[gene|B791B0603042603CB5B5E03CA129B20D02BC02BC|yfkN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCAGTTCTCCACCTTTCA, downstream forward: _UP4_TAAAAAAGAGCTGCTCGCTAReferences
14688230,16291680,18957862,12850135,17114254,21800427,27414497,27681641