SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


essential for viability in the presence of catechol
14.28 kDa
protein length
134 aa Sequence Blast
gene length
405 bp Sequence Blast
detoxification of catechol

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    897,588 → 897,992

    Phenotypes of a mutant

  • not viable in the presence of catechol [pubmed|30377275]
  • The protein

    Protein family

  • DoxX family (with [protein|B4384C8C0874BAA7822E9B6DCAB57790018271D8|MhqP], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20639328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [Pubmed|20639328], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]: repression, [Pubmed|20639328], in [regulon|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|30377275], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • strong induction by diamide and quinones (such as catechol) ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]) [Pubmed|16872404,20639328]
  • induced by iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|30377275]
  • view in new tab

    Biological materials


  • MGNA-C294 (yfiD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08230 (Δ[gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCTCCTTGATAA, downstream forward: _UP4_GCATAAGAAAAGAGGCATGC
  • BKK08230 (Δ[gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCTCCTTGATAA, downstream forward: _UP4_GCATAAGAAAAGAGGCATGC
  • References

  • 17407181,16872404,20639328,30377275